Study of the associations between polymorphic markers rs1800629 TNFa, rs909253 Lta, rs767455 TNFR1, rs1061624 TNFR2 and the development of type 2 diabetes

Cover Page

Abstract


Aim. To study the association between polymorphic genetic markers, tumor necrosis factors and their receptors (rs 1800629 TNFα, rs 909253 Ltα, rs 767455 TNFR1, rs 1061624 TNFR2) and the development of type 2 diabetes (T2D) among the population of the Central Black Earth Region of Russia.

Materials and methods. The results obtained from 544 patients, of which 236 were already diagnosed with T2D and 308 were healthy control individuals, were analysed. All the loci were analysed by DNA synthesis using PCR TaqMan probes. The statistical analysis of the frequency distribution of genotypes was performed using contingency tables and the χ2 test, with p ≤ 0.05.

Results. A case-control analysis showed that genotype GG rs 909253Ltα was a risk factor for T2D (OR = 2.36, p = 0.01). Also, individuals with genotype AA rs 767455TNFR1 had significantly earlier age of T2D manifestation than that of patients with genetic variants AG and GG (p = 0.01).

Conclusion. This study demonstrated the involvement of polymorphic markers of tumor necrosis factors and their receptors in the development of T2D among the residents of the Central Black Earth Region of Russia.


Cахарный диабет 2 типа (СД2) – самое распространенное эндокринное заболевание, которое представляет собой одну из острейших медико-социальных проблем, так как ведет к ранней инвалидизации и повышению смертности среди населения вследствие развития различных осложнений [1]. В настоящее время более 415 млн человек в возрасте от 20 до 79 лет в мире страдают СД, в 90% случаев это СД2. В России более 4 млн человек больны СД, из них 3,7 млн – СД2 [2]. По частоте инвалидизации и смертности СД стоит на 3-м месте после сердечно-сосудистых заболеваний и онкопатологии. Между тем, результаты контрольно-эпидемиологических исследований, проведенных ФГБУ «Эндокринологический научный центр» (ЭНЦ) МЗ РФ в период с 2002 по 2010 гг., показали, что истинная численность больных СД в России приблизительно в 3–4 раза больше официально зарегистрированной и достигает 9–10 млн человек, что составляет около 7% населения [3].

СД2 относят к мультифакториальным заболеваниям. Согласно литературным данным, роль генетических факторов в развитии СД2 составляет 15–50% [4]. Научные исследования последних лет показали, что важное значение в развитии СД2 играют цитокины, которые способствуют развитию инсулинорезистентности, причем одними из ключевых медиаторов ее развития являются факторы некроза опухоли [5]. Обладая множеством медико-биологических эффектов (оказывают иммуномодулирующее, цитотоксическое и провоспалительное действие, стимулируют липолиз, активируют систему гемостаза, индуцируют апоптоз и др.), факторы некроза опухоли (фактор некроза опухоли-α (TNFα), лимфотоксин-α (Ltα)) могут влиять на развитие и прогрессирование СД2 [6].

Так, гиперпродукция TNFα приводит к снижению чувствительности к действию инсулина и, как следствие, изменению метаболизма глюкозы в жировой, мышечной тканях и печени. Также установлено, что при наличии ожирения и инсулинорезистентности TNFα, синтезируемый в жировой и мышечной ткани, обнаруживается в больших количествах и обладает возможностью проявлять пара- и аутокринные свойства [7]. Ltα является хемоаттрактантом для нейтрофилов, стимулирует в них образование пероксид-ионов, усиливает фагоцитоз и адгезию к эндотелию, стимулирует активность фибробластов, а также провоцирует выработку стресс-гормонов, влияет на метаболизм глюкозы [8]. Свои медико-биологические эффекты факторы некроза опухоли (TNFα, Ltα) реализуют через специфические рецепторы 1-го и 2-го типа (TNFR1 и TNFR2 соответственно). TNFR1 несет ответственность за острый воспалительный ответ и экспрессируется в большинстве типов клеток. TNFR2 участвует главным образом в реализации метаболических эффектов факторов некроза опухолей, а именно регулирует жировой и углеводный обмен. Таким образом, факторы некроза опухоли через свои рецепторы могут влиять на развитие и прогрессирование СД2.

С молекулярно-генетических позиций СД2 изучается достаточно активно как за рубежом, так и в Российской Федерации [9]. Однако результаты работ, посвященных изучению связей генов-кандидатов факторов некроза опухоли и их рецепторов с развитием СД2, неоднозначны в разных популяциях. Так, например, показано, что аллель А rs1800629TNFα является фактором риска формирования СД2 в иранской (OR=2,34) [10], индийской (OR=3,21) [11] и бразильской (OR=1,82) [12] популяциях. Среди населения Хорватии и Венгрии данных ассоциаций выявлено не было [13], а в популяции Мексики установлено, что фактором риска развития СД2 является генотип GGrs1800629 TNFα (OR=3,64) [14].

Роль полиморфных маркеров генов факторов некроза опухоли и их рецепторов в отношении СД2 в нашей стране изучена недостаточно, что диктует необходимость проведения данных исследований в различных популяциях Российской Федерации.

Цель

Целью настоящей работы было изучение ассоциации полиморфных маркеров факторов некроза опухоли и их рецепторов (rs1800629 TNFα, rs909253 Ltα, rs767455 TNFR1, rs1061624 TNFR2) с формированием СД2 среди населения Центрального Черноземья РФ.

Материалы и методы

Проведен анализ результатов наблюдений 544 человек: 236 пациентов с установленным диагнозом СД2 и 308 человек контрольной группы. В выборки больных СД2 и контроля включались индивидуумы русской национальности, являющиеся уроженцами Центрального Черноземья России и не имеющие родства между собой. Диагноз СД2 устанавливался после детального клинического, лабораторного обследования пациентов в отделении эндокринологии Белгородской областной клинической больницы Святителя Иоасафа на основании критериев Комитета экспертов ВОЗ (1999) и Федеральной целевой программы «Сахарный диабет» (2002). В группу контроля включались индивидуумы без наличия СД2. Все пациенты подписали информированное согласие на проведение исследования.

Исследуемые группы были сопоставимы по основным биологическим показателям: полу, возрасту и индексу массы тела (табл. 1).

 

Таблица 1. Медико-биологические и клинико-лабораторные характеристики исследуемых групп, х±SD

Показатель

Больные (N=236)

Контроль (N=308)

p

Пол (м/ж)

64/172

82/226

>0,05

Возраст, лет

57,85±6,11

60,20±6,28

>0,05

Возраст манифестации, лет

48,2±0,48

-

-

Длительность диабета, лет

9,7±0,37

-

-

Индекс массы тела, кг/м2

29,7±4,8

27,3±5,5

>0,05

Гликированный гемоглобин, %

8,77± 0,13

-

-

Уровень глюкозы натощак, ммоль/л

9,6±1,7

5,6±1,1

<0,05

Уровень глюкозы плазмы через 2 ч после приема пищи, ммоль/л

-

6,8±0,8

-

Базальный уровень инсулина, мкЕд/мл

14,8±9,1

10,2±4,9

<0,05

Уровень инсулина через 2 ч после приема пищи, мкЕд/л

-

46,5±21,7

-

Удельный вес пациентов с наследственной отягощенностью по СД2, n,%

103 (43,64)

-

-

Примечание: х – среднее, SD – стандартное квадратичное отклонение

 

Материалом для молекулярно-генетического исследования послужила венозная кровь в объеме 8–9 мл, взятая из локтевой вены пробанда. Выделение геномной ДНК из периферической крови проведено методом фенольно-хлороформной экстракции.

Анализ всех локусов (rs1800629 TNFα, rs909253 Ltα, rs767455 TNFR1, rs1061624 TNFR2) осуществлялся методом полимеразной цепной реакции (ПЦР) синтеза ДНК. ПЦР проводилась на амплификаторе IQ5 производства компании Bio-Rad с использованием ДНК-полимеразы Thermusaquaticus производства фирмы «Силекс-М», г. Москва и олигонуклеотидных праймеров и зондов, синтезированных фирмой «Синтол» г. Москва (табл. 2). Генотипирование осуществлялось методом дискриминации аллелей с использованием TaqMan зондов. Обозначения полиморфных маркеров даны в соответствии с базой данных dbSNP.

 

Таблица 2. Условия амплификации, последовательности праймеров и флуоресцентных зондов

Ген

Полиморфный маркер

Последовательность

праймеров и зондов, 5`-3`

Температура отжига, °С

TNFα

G/A

rs1800629

GAAATGGAGGCAATAGGTTTTGAG

GGCCACTGACTGATTTGTGTGTAG

FAM-CCGTCCTCATGCC- RTQ1

ROX-CCGTCCCCATGCC – RTQ1

52

Ltα

A/G

rs909253

CAGTCTCATTGTCTCTGTCACACATT

ACAGAGAGAGACAGGAAGGGAACAFAM:CCATGGTTCCTCTC-RTQ1

ROX:CTGCCATGATTCC-RTQ1

50

TNFR1

A/G

rs767455

AGCCCACTCTTCCCTTTGTC

CCACCGTGCCTGACCTG

FAM: CTGCTGCCACTGGT-RTQ1

ROX: CTGCTGCCGCTGGT-BHQ2

62

TNFR2

A/G

rs1061624

TGACCTGCAGGCCAAGAG

CCATGGCAGCAGAGGCTTT

FAM: CACAACCCGCTGCC – RTQ1

ROX: CCACAACTCGCTGCC – BHQ2

59

 

Формирование базы данных и статистические расчеты осуществлялись с использованием программы STATISTICA 6.0. Определение фенотипических и генных частот проводили стандартными методами. Для оценки соответствия наблюдаемого распределения ожидаемому, исходя из равновесия Харди-Вайнберга, использовали критерий χ2.

Статистический анализ распределения частот генотипов проводили с использованием таблиц сопряженности и критерия хи-квадрат (χ2) с поправкой Йетса на непрерывность и отношения шансов (OR) с 95% доверительным интервалом (CI). При сравнительном анализе качественных показателей, характеризующих больных СД2 и контрольную группу, использовали непараметрическую статистику (критерий Манна-Уитни) [15].

Этическая экспертиза

По результатам рассмотрения протокола исследования этическим комитетом Белгородского государственного университета решено «Разрешить проведение исследования «Клинико-генетическое исследование больных сахарным диабетом 2 типа»» (Белоусова О.Н., кафедра медико-биологических дисциплин), протокол №3 от 14.05.2009.

Результаты и обсуждение

Изучение частот генотипов изучаемых генетических маркеров показало, что для всех рассмотренных локусов в контрольной выборке и в группе больных СД2 эмпирическое распределение генотипов соответствует теоретически ожидаемому при равновесии Харди-Вайнберга (p>0,05), а наблюдаемая гетерозиготность (Н0) не отличается от ожидаемой гетерозиготности (НЕ) (р>0,05).

Анализ методом «случай-контроль» (больные СД2 – здоровые лица) показал наличие статистически значимой ассоциации полиморфного маркера rs909253Ltα с развитием СД2: генотип GG повышает риск развития СД2 (OR=2,36, р=0,01) (табл. 3).

 

Таблица 3. Распределение полиморфных маркеров генов факторов некроза опухоли и их рецепторов у больных СД2 и в контрольной группе

Локусы

Аллели, генотипы

Больные СД2 (n=236)

Контрольная группа (n=308)

ОR (95% СI)

χ2; p

n (%)

n (%)

rs909253 Ltα

A

341 (72,25)

473 (77,04)

0,77 (0,58–1,03)

χ2=3,01; p=0,08

G

131 (27,75)

141 (22,96)

1,29 (0,97–1,74)

χ2=3,01; p=0,08

AA

129 (54,66)

180 (58,63)

0,85 (0,59–1,81)

χ2=0,70; p=0,40

AG

83 (35,16)

113 (36,80)

0,93 (0,64–1,34)

χ2=0,09; p=0,76

GG

24 (10,18)

14 (4,57)

2,36 (1,14–4,95)

χ2=5,61; p=0,01

H0(HE), PHWE

0,35 (0,40), >0,05

0,36 (0,35), >0,05

  

rs1800629 TNFα

G

405 (85,81)

539 (88,94)

0,75 (0,91–1,94)

χ2=2,12; p=0,14

A

67 (14,19)

67 (11,06)

1,33 (0,51–1,09)

χ2=2,12; p=0,14

GG

176 (74,57)

242 (79,87)

0,73 (0,48–1,13)

χ2=1,84; p=0,17

AG

53 (22,45)

55 (18,15)

1,30 (0,83–2,05)

χ2=1,27; p=0,25

AA

7 (2,98)

6 (1,98)

1,51 (0,45–5,15)

χ2=0,20; p=0,64

H0(HE), PHWE

0,22 (0,24), >0,05

0,18 (0,19),>0,05

  

rs767455 TNFR1

G

237 (50,42)

318 (51,62)

0,94 (0,73–1,21)

χ2=0,16; p=0,68

A

235 (49,58)

298 (48,38)

1,05 (0,82–1,35)

χ2=0,16; p=0,68

GG

66 (27,96)

76 (24,68)

1,18 (0,79–1,77)

χ2=0,58; p=0,44

AG

106 (44,91)

166 (53,89)

0,69 (0,48–0,99)

χ2=3,95; p=0,04

AA

64 (27,13)

66 (21,43)

1,36 (0,90–2,06)

χ2=2,07; p=0,15

H0(HE), PHWE

0,44 (0,50) >0,05

0,53 (0,49) >0,05

  

rs1061624 TNFR2

G

272 (57,63)

341 (55,74)

1,07 (0,83–1,37)

χ2=0,25; p=0,61

A

200 (42,37)

269 (44,26)

0,93 (0,72–1,19)

χ2=0,25; p=0,61

GG

81 (34,32)

101 (33,12)

1,05 (0,72–1,53)

χ2=0,04; p=0,83

AG

110 (46,61)

138 (45,24)

1,05 (0,74–1,50)

χ2=0,05; p=0,81

AA

45 (19,07)

66 (21,64)

0,85 (0,54–1,33)

χ2=0,39; p=0,53

H0(HE), PHWE

0,46(0,48) >0,05

0,43(0,49), >0,05

  

Примечание: H0 и HE – наблюдаемая и ожидаемая гетерозиготность

 

Следует отметить, что полученные нами данные соответствуют литературным материалам о биологическом значении Ltα в организме. Так, согласно работе Brian E. C. (2009), он обладает выраженным провоспалительным, цитотоксическим, иммуномодулирующим действиями, и именно эти механизмы его действия имеют одно из важных значений в этиопатогенезе СД2 [16]. При этом следует подчеркнуть, что генотип GG rs909253Ltα контролирует повышенную продукцию Ltα. Поэтому у индивидуумов с данным маркером мы можем ожидать и более выраженные этио патогенетические эффекты Ltα [17]. Следует отметить, что нами впервые установлено важное значение локуса rs909253 Ltα при СД2 среди населения России.

По другим исследуемым генетическим полиморфизмам достоверных различий в частотах аллелей и генотипов не обнаружено (p>0,05).

При анализе возраста манифестации СД2 установлено, что индивидуумы с генотипом AArs767455TNFR1 имеют более ранний возраст манифестации СД2 (х±SD=47,01±0,92) по сравнению с больными с генетическими вариантами AG и GGrs767455TNFR1 (х±SD=48,99±0,72, р=0,01) (табл. 4).

 

Таблица 4. Медико-биологические и клинические характеристики больных СД2 в зависимости от генотипов локуса rs767455TNFR1, х±SD

Показатели

Генотип по локусу rs767455 TNFR1

р

АА (n=64)

АG и GG (n=175)

Возраст, лет

56,93±0,79

58,53±0,76

0,06

Возраст манифестации, лет

47,01±0,92

48,99±0,72

0,01

Длительность диабета, лет

9,92±0,67

9,60±0,59

0,06

Индекс массы тела, кг/м2

31,71±0,68

33,19±0,49

0,06

Гликированный гемоглобин, %

9,12±0,25

8,65±0,22

0,06

Примечание: х – среднее, SD – стандартное квадратичное отклонение

 

Полученные данные свидетельствуют о значимом влиянии rs767455TNFR1 на возраст манифестации СД2. Согласно литературным данным [18], рецептор фактора некроза опухолей 1-го типа (TNFR1) опосредует все виды действия факторов некроза опухолей, тем самым участвуя в реализации широкого спектра биологических процессов в организме (митогенные факторы в апоптозе адипоцитов, стимуляция секреции лептина и регуляция функции митохондрий, участие в регуляции обмена углеводов и жиров, индукция инсулинорезистентности в жировой ткани и мышцах, подавление секреции инсулина β-клетками островков поджелудочной железы), имеющих важное значение в этиопатогенезе СД2 [19]. Как свидетельствуют данные литературы, генотип АА rs767455TNFR1 связан с усилением экспрессии рецептора фактора некроза опухолей 1-го типа [20], что может обуславливать ранний возраст манифестации СД2.

Заключение

Таким образом, резюмируя полученные в настоящей работе данные, следует отметить, что впервые продемонстрировано важное значение полиморфных маркеров генов Ltα (rs909253Ltα) и рецептора фактора некроза опухоли 1-го типа (rs 767455 TNFR1) в формировании СД2 на выборке из русских жителей Центрального Черноземья России. Генотип GG rs909253Ltα является фактором риска развития СД2 (OR=2,36), индивидуумы с генотипом AA rs767455TNFR1 имеют более ранний возраст манифестации СД2 по сравнению с больными, имеющими генетические варианты AG и GGrs767455TNFR1 (р=0,01).

Дополнительная информация

Финансирование исследования

Финансирование исследования осуществлялось за счет Стипендии Президента РФ.

Конфликт интересов

Авторы декларируют отсутствие явных и потенциальных конфликтов интересов, связанных с публикацией настоящей статьи.

Участие авторов

Чурносов М.И. – концепция и дизайн исследования, написание текста; Белоусова О.Н. – сбор и обработка материала, написание текста; Сиротина С.С. – анализ полученных данных, написание текста.

Mikhail I. Churnosov

churnosov@bsu.edu.ru
ORCID iD: 0000-0002-9319-7185
SPIN-code: 7407-9649
Belgorod National Research University
Russian Federation, 85, Pobeda street, Belgorod, 308015

MD, PhD, Professor

Oksana N. Belousova

belousova@bsu.edu.ru
ORCID iD: 0000-0003-0588-1436
SPIN-code: 2272-2670
Belgorod National Research University
Russian Federation, 85, Pobeda street, Belgorod, 308015

MD, PhD

Svetlana Sergeyevna Sirotina

Author for correspondence.
sirotina@bsu.edu.ru
ORCID iD: 0000-0002-4163-7863
SPIN-code: 4242-8166
Belgorod National Research University
Russian Federation, 85, Pobeda street, Belgorod, 308015

PhD in Biology

  • Hemmingsen B, Christensen LL, Wetterslev J, et al. Comparison of metformin and insulin versus insulin alone for type 2 diabetes: systematic review of randomised clinical trials with meta-analyses and trial sequential analyses. BMJ. 2012;344:e1771. doi: 10.1136/bmj.e1771.
  • Дедов И.И., Шестакова М.В., Викулова О.К. Государственный регистр сахарного диабета Российской Федерации: статус 2014 г. и перспективы развития. // Сахарный диабет. — 2015. — Т. 18. — № 3. — С. 5-23. [Dedov II, Shestakova MV, Vikulova OK. National register of diabetes mellitus in Russian Federation: status on 2014. Diabetes mellitus. 2015;18(3):5-23 (in Russ.)] doi: 10.14341/DM201535-22.
  • Дедов И.И., Шестакова М.В., Галстян Г.Р., и др. Алгоритмы специализированной медицинской помощи больным сахарным диабетом. Под редакцией И.И. Дедова, М.В. Шестаковой (7-й выпуск). // Сахарный диабет. – 2015. – Т. 18. – № 1S. – C. 1-112. [Dedov II, Shestakova MV, Galstyan GR, et al. Standards of specialized diabetes care. Edited by Dedov II, Shestakova MV (7-th edition). Diabetes mellitus. 2015;18(1S):1-112. (in Russ.)] doi: 10.14341/DM20151S.
  • Бондарь И.А., Шабельникова О.Ю. Генетические основы сахарного диабета 2 типа. // Сахарный диабет. – 2013. – Т. 16 – № 4. – С. 11-16. [Bondar' IA, Shabel'nikova OJ. Genetic framework of type 2 diabetes mellitus. Diabetes mellitus. 2013;16(4):11-16. (in Russ.)] doi: 10.14341/DM2013411-16.
  • Dehwah MA, Wang M, Huang QY. CDKALl and type 2 diabetes: a global meta-analysis. Genet Mol Res. 2010;9(2):1109-1120. doi: 10.4238/vol9-2gmr802.
  • Grigorescu F, Attaoua R, Ait Mkadem ES, Radian S. Susceptibility genes for insulin resistance and type 2 diabetes. In: Cheta D, editor. Genetics of diabetes. Basel: Karger AG; 2010. p. 131–192.
  • Гумилевский Б.Ю., Гумилевская О.П. Аллельный полиморфизм генов цитокинов при хроническом отторжении ренального трансплантата. // Вестник Волгоградского государственного медицинского университета. – 2010. – Т. 35. – № 3. – С. 62-65. [Gumilevskiy BY, Gumilevskaya OP. Allelic polymorphism of cytokine genes in chronic renal transplant rejection. Vestnik Volgogradskogo gosudarstvennogo medicinskogo universiteta. 2010;35(3):62-65. (in Russ.)]
  • Кетлинский С.А., Симбирцев А.С. Цитокины. – СПб.: Фолиант; 2008. [Ketlinskiy SA., Simbircev AS. Citokiny. Saint-Peterberg: Foliant; 2008. (In Russ.)]
  • Schafer SA, Machicao F, Fritsche A, et al. New type 2 diabetes risk genes provide new insights in insulin secretion mechanisms. Diabetes Res Clin Pract. 2011;93(1):9–24. doi: 10.1016/S0168–8227(11)70008-0.
  • Golshani H, Haghani K, Dousti M, Bakhtiyari S. Association of TNF-α 308 G/A Polymorphism With Type 2 Diabetes: A Case-Control Study in the Iranian Kurdish Ethnic Group. Osong Public Health Res Perspect. 2015;6(2):94-9. doi: 10.1016/j.phrp.2015.01.003.
  • Dhamodharan U, Viswanathan V, Krishnamoorthy E, et al. Genetic association of IL-6, TNF-α and SDF-1 polymorphisms with serum cytokine levels in diabetic foot ulcer. Gene. 2015;565(1):62-7. doi: 10.1016/j.gene.2015.03.063.
  • Sesti LEC, Crispim D, Canani LH, et al. The -308G>a polymorphism of the TNF gene is associated with proliferative diabetic retinopathy in Caucasian Brazilians with type 2 diabetes. Invest Ophthalmol Vis Sci. 2015;56(2):1184-90. doi: 10.1167/iovs.14-15758.
  • Temesszentandrasi G, Voros K, Borocz Z, et al. Association of human fetuin-A rs4917 polymorphism with obesity in 2 cohorts. J Investig Med. 2015;63(3):548-53. doi: 10.1097/JIM.0000000000000151.
  • Garcia-Elorriaga G, Mendoza-Aguilar M, del Rey-Pineda G, Gonzalez-Bonilla C. Genetic polymorphisms of the tumor necrosis factor and lymphotoxin alpha in type 2 diabetes. Rev Med Inst Mex Seguro Soc. 2013;51(1):42-49.
  • Реброва О.Ю. Статистический анализ медицинских данных. Применение пакета прикладных программ Statistica. – М.: Медиа Сфера; 2006. [Rebrova OY. Statisticheskiy analiz medicinskih dannyh. Primenenie paketa prikladnyh program Statistica. Moscow: Media Sfera; 2006. (in Russ.)]
  • Brian EC. Peripheral receptor targets for analgesia: novel approaches to pain treatment. New Jersey: Wiley & Sons; 2009.
  • Okuse K. Pain signalling pathways: From cytokines to ion channels. The International Journal of Biochemistry & Cell Biology. 2007;39(3):490-496. doi: 10.1016/j.biocel.2006.11.016.
  • Sanghera DK, Blackett PR. Type 2 Diabetes Genetics: Beyond GWAS. J Diabetes Metab. 2012;03(05):2-17. doi: 10.4172/2155-6156.1000198.
  • Scott RA, Lagou V, Welch RP. Large-scale association study using the Metabochip array reveals new loci influencing glycemic traits and provides insight into the underlying biological pathways. Nat Genet. 2012;44(9):991–1005. doi: 10.1038/ng.2385.
  • Vendrell J, Broch M, Fernandez-Real JM, et al. Tumour necrosis factor receptors (TNFRs) in Type 2 diabetes. Analysis of soluble plasma fractions and genetic variations of TNFR2 gene in a case-control study. Diabet Med. 2005;22(4):387-92. doi: 10.1111/j.1464-5491.2004.01392.x.

Supplementary files

There are no supplementary files to display.

Views

Abstract - 596

PDF (Russian) - 504

PDF (English) - 87


Copyright (c) Churnosov M.I., Belousova O.N., Sirotina S.S.

Creative Commons License
This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License.